Archives

  • 2019-10
  • 2020-07
  • 2020-08
  • br In this study to address the aforementioned

    2020-08-03


    In this study, to address the aforementioned issues, curcumin as a hydrophobic drug was encapsulated in human serum albumin nanopar-ticles via desolvation method. Furthermore, for targeted drug delivery to HER2 positive breast cancer cells, a HER2-bonding aptamer (HB5) was conjugated to the surface of albumin nanoparticles through EDC/ NHS reagents. The cellular uptake of targeted NPs by HER2 positive breast cancer cells has been compared to the HER2 negative cells. The obtained aptamer-functionalized NPs show tumor cell-targeting ability for HER2 positive breast cancer cells (SK-BR3) attributed to the surface aptamer modification.
    2. Materials and methods
    N-hydroxysulfosuccinimide (NHS), 1-ethyl3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC), 3-(4, 5-dimethythiazol-2-yl)-2, 5-diphenyl tetrazolium bromide (MTT), and Human Serum Albumin (HSA) were purchased from Sigma-Aldrich (USA). Curcumin (CB0346) was purchased from Bio Basic Inc. The cell culture medium (DMEM) and Benazepril (penicillin, streptomycin) were obtained from GibcoBRL (Life Technologies, Paisley, Scotland), fetal bovine serum (FBS) was obtained from Biosera (England). Other salts and solvents were purchased from Merck (Germany). All materials were used without any further purification.
    MCF-7 and SK-BR3 cells were a kind gift from Department of Immu-nology, School of Public Health, Tehran University of Medical Sciences.
    An ssDNA-aptamer for HER-2 antigen reported previously [10] was employed as the targeting ligand. The 3′-NH2 and 5′-Cy5 modified HB5 DNA aptamer (HB5 sequence: 5′AACCGCCCAAATCCCTAAGAGTCT GCACTTGTCATTTTGTATATGTATTTGGTTTTTGGCTCTCACAGACACACTA CACACGCACA-3′, 86 bp) was synthesized by Calgary University (Canada). 
    2.2. Preparation of HSA nanoparticles
    Curcumin-loaded HSA nanoparticles were prepared by a desolvation method, as described previously with minor modifications [22]. In es-sence, 100 mg of HSA was dissolved in 1.0 mL of Milli-Q water. Under constant stirring at 550 rpm at room temperature, CCM solution (4 mg in 1.0 mL ethanol) was added with the rate of 1.0 mL/min until turbidity was appeared in the solution. Then, 20 μL of 25% glutaralde-hyde solution was added to induce particle crosslinking under stirring of the suspension over a time period of 12 h. For purification of HSA NPs, the coarse particles were removed by centrifugation at 5000 ×g for 3 min at 4 °C. The supernatant were purified by three cycles of cen-trifugation (28,000 ×g, 20 min at 4 °C) in water at pH 7.4, the pellet of which was redispersed using an ultrasonication bath (Wised WUC-D10H) for 5 min. In order to prepare blank HSA NPs, 1.0 mL ethanol without CCM was added to HSA solution and experiments performed as mentioned above.
    2.3. Determination of particle size and size distribution
    Hydrodynamic diameter, size distribution and zeta potential of nanoparticles were determined via dynamic light scattering (DLS) (Brookhaven Instrument, USA). Morphology of the nanoparticles was identified by scanning electron microscopy (SEM). The SEM procedure was performed by drying of NPs suspension, gold sputter coating, and examining with SEM (MIRA\ \TESCAN) using acceleration voltage of 10 kV.
    2.4. Drug loading and encapsulation efficiency
    In order to determine drug loading efficiency (DLE) and drug encap-sulation efficiency (DEE), CCM-loaded HSA nanoparticles were isolated by centrifugation (20,000 ×g, 20 min at 4 °C). The supernatant was col-lected and amount of free CCM was measured via spectrophotometer at 420 nm. The amount of entrapped CCM in NPs formulation was calcu-lated by subtracting the amount of free CCM from the total CCM. Drug loading efficiency (DLE) (%) and drug encapsulation efficiency (DEE)
    DLE ð%Þ ¼ Weight of entrapped CCM in NPs 100 ð1Þ
    The total weight of nanoparticles
    DEE ð%Þ ¼ Total Weight of initial CCM used–free non−entrapped CCM Total Weight of initial CCM used
    2.5. In vitro drug release study
    Drug release from NPs was studied at 37 °C in four different condi-tions, as described previously with minor modifications [23], including:
    10 mM GSH which resembles the intracellular condition, (3) acetate buffer pH 5.5 similar to microenvironment of tumor and (4) acetate buffer pH 5.5 containing 10 mM GSH corresponds to the lysosomal en-vironment [17]. 0.5% SDS was used in all release buffers to maintain a sink condition and facilitate the release of CCM in buffer media [24]. Then, accurately weighed of CCM/HSA NPs solution was divided in a number of Eppendorf tubes (1 mg/mL). The tubes were incubated at 37 °C and shaken at 150 rpm. At predetermined time intervals, each tube was centrifuged at 3000 rpm for 30s to separate the released (pelleted) CCM from the nanoparticles. 1 mL of ethanol was added to pellet CCM due to insolubility of free CCM in water. Therefore, CCM was re-dissolved in solution and the absorbance was measured spectro-photometrically at 428 nm to determine the amount of CCM released in